Since we're bumping it as a useful read, I will add this stuff. Read it at your leisure, it's a lot of scientific mumbo-jumbo... but it explains some of the science behind why stuff doesn't work.
There are several different types of mutations. I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA makes an acid called Histidine. The CGC makes an acid called Alanine. And so on.
Nonsense, as Allie said, stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.
Substitution mutations are when one letter gets changed for another. So GTACGCA could become GCACGCA, changing the GTA to GCA, which changes the amino acid from Histidine to Arginine.
Frameshift mutations are called additions or deletions. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. If you delete a letter, it might change our GTACGCA to something like GACGCA. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.
There are also splice mutations (like mine, called 1898+1G>A), and I don't know exactly how those work. I didn't learn that in my bio class. Hahaha. But I imagine it squishes two of those letters together, again changing the amino acids in the chain.
I know this is really kind of confusing, if anyone needs anything further explained or rephrased, just ask and I'll try my best.
