Sitting here in tears and am shocked (update)

E

Emily65Roses

New member
Sitting here in tears and need advice

No, the w1282x is not a deletion mutation, it's a nonsense mutation. And yes, Delta F508 is a deletion mutation.

This is going to be scientific babble, but I can't think of an easier way to put it:

I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA (after the RNA process) makes an acid called Histidine. The CGC makes an acid called Alanine. And so on

<u>Nonsense</u> stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.

Frameshift mutations are called additions or <u>deletions</u>. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. <b>If you delete a letter, it might change our GTACGCA to something like GACGCA <i>The T has been deleted</i>. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.</b>
 
E

Emily65Roses

New member
Sitting here in tears and need advice

No, the w1282x is not a deletion mutation, it's a nonsense mutation. And yes, Delta F508 is a deletion mutation.

This is going to be scientific babble, but I can't think of an easier way to put it:

I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA (after the RNA process) makes an acid called Histidine. The CGC makes an acid called Alanine. And so on

<u>Nonsense</u> stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.

Frameshift mutations are called additions or <u>deletions</u>. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. <b>If you delete a letter, it might change our GTACGCA to something like GACGCA <i>The T has been deleted</i>. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.</b>
 
E

Emily65Roses

New member
Sitting here in tears and need advice

No, the w1282x is not a deletion mutation, it's a nonsense mutation. And yes, Delta F508 is a deletion mutation.

This is going to be scientific babble, but I can't think of an easier way to put it:

I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA (after the RNA process) makes an acid called Histidine. The CGC makes an acid called Alanine. And so on

<u>Nonsense</u> stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.

Frameshift mutations are called additions or <u>deletions</u>. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. <b>If you delete a letter, it might change our GTACGCA to something like GACGCA <i>The T has been deleted</i>. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.</b>
 
E

Emily65Roses

New member
Sitting here in tears and need advice

No, the w1282x is not a deletion mutation, it's a nonsense mutation. And yes, Delta F508 is a deletion mutation.

This is going to be scientific babble, but I can't think of an easier way to put it:

I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA (after the RNA process) makes an acid called Histidine. The CGC makes an acid called Alanine. And so on

<u>Nonsense</u> stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.

Frameshift mutations are called additions or <u>deletions</u>. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. <b>If you delete a letter, it might change our GTACGCA to something like GACGCA <i>The T has been deleted</i>. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.</b>
 
E

Emily65Roses

New member
Sitting here in tears and need advice

No, the w1282x is not a deletion mutation, it's a nonsense mutation. And yes, Delta F508 is a deletion mutation.

This is going to be scientific babble, but I can't think of an easier way to put it:

I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA (after the RNA process) makes an acid called Histidine. The CGC makes an acid called Alanine. And so on

<u>Nonsense</u> stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.

Frameshift mutations are called additions or <u>deletions</u>. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. <b>If you delete a letter, it might change our GTACGCA to something like GACGCA <i>The T has been deleted</i>. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.</b>
 
E

Emily65Roses

New member
Sitting here in tears and need advice

No, the w1282x is not a deletion mutation, it's a nonsense mutation. And yes, Delta F508 is a deletion mutation.

This is going to be scientific babble, but I can't think of an easier way to put it:

I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA (after the RNA process) makes an acid called Histidine. The CGC makes an acid called Alanine. And so on

<u>Nonsense</u> stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.

Frameshift mutations are called additions or <u>deletions</u>. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. <b>If you delete a letter, it might change our GTACGCA to something like GACGCA <i>The T has been deleted</i>. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.</b>
 
M

my65roses4me

New member
Sitting here in tears and need advice

I am happy to learn that the mutations that I have are being studied and look promising.

I guess that is my whole point about all of this is that all along the studies pertain to me and I didn't even know it. This news that I have gotten is good news and thats why I feel cheated. But at the same time I feel a little more hope for my future with all the news meds that are being studied!!!

I hope I didn't make this sound like its bad news. Its not at all. I am crying out of happiness and shock and a little hurt that I had to find out like this, I wish I knew all along!
It just makes me look at things differently now. I am 32 yrs old and have always thought of myself very informed about my disease. Which I still am but its different now. I need to keep up on the studies that are happening that I thought I couldn't be a part of. I am on the study bandwagon now!!!!!!

Dr's here I come. I want to be a guinee pig again!!!!!! LOL!!!!
 
M

my65roses4me

New member
Sitting here in tears and need advice

I am happy to learn that the mutations that I have are being studied and look promising.

I guess that is my whole point about all of this is that all along the studies pertain to me and I didn't even know it. This news that I have gotten is good news and thats why I feel cheated. But at the same time I feel a little more hope for my future with all the news meds that are being studied!!!

I hope I didn't make this sound like its bad news. Its not at all. I am crying out of happiness and shock and a little hurt that I had to find out like this, I wish I knew all along!
It just makes me look at things differently now. I am 32 yrs old and have always thought of myself very informed about my disease. Which I still am but its different now. I need to keep up on the studies that are happening that I thought I couldn't be a part of. I am on the study bandwagon now!!!!!!

Dr's here I come. I want to be a guinee pig again!!!!!! LOL!!!!
 
M

my65roses4me

New member
Sitting here in tears and need advice

I am happy to learn that the mutations that I have are being studied and look promising.

I guess that is my whole point about all of this is that all along the studies pertain to me and I didn't even know it. This news that I have gotten is good news and thats why I feel cheated. But at the same time I feel a little more hope for my future with all the news meds that are being studied!!!

I hope I didn't make this sound like its bad news. Its not at all. I am crying out of happiness and shock and a little hurt that I had to find out like this, I wish I knew all along!
It just makes me look at things differently now. I am 32 yrs old and have always thought of myself very informed about my disease. Which I still am but its different now. I need to keep up on the studies that are happening that I thought I couldn't be a part of. I am on the study bandwagon now!!!!!!

Dr's here I come. I want to be a guinee pig again!!!!!! LOL!!!!
 
M

my65roses4me

New member
Sitting here in tears and need advice

I am happy to learn that the mutations that I have are being studied and look promising.

I guess that is my whole point about all of this is that all along the studies pertain to me and I didn't even know it. This news that I have gotten is good news and thats why I feel cheated. But at the same time I feel a little more hope for my future with all the news meds that are being studied!!!

I hope I didn't make this sound like its bad news. Its not at all. I am crying out of happiness and shock and a little hurt that I had to find out like this, I wish I knew all along!
It just makes me look at things differently now. I am 32 yrs old and have always thought of myself very informed about my disease. Which I still am but its different now. I need to keep up on the studies that are happening that I thought I couldn't be a part of. I am on the study bandwagon now!!!!!!

Dr's here I come. I want to be a guinee pig again!!!!!! LOL!!!!
 
M

my65roses4me

New member
Sitting here in tears and need advice

I am happy to learn that the mutations that I have are being studied and look promising.

I guess that is my whole point about all of this is that all along the studies pertain to me and I didn't even know it. This news that I have gotten is good news and thats why I feel cheated. But at the same time I feel a little more hope for my future with all the news meds that are being studied!!!

I hope I didn't make this sound like its bad news. Its not at all. I am crying out of happiness and shock and a little hurt that I had to find out like this, I wish I knew all along!
It just makes me look at things differently now. I am 32 yrs old and have always thought of myself very informed about my disease. Which I still am but its different now. I need to keep up on the studies that are happening that I thought I couldn't be a part of. I am on the study bandwagon now!!!!!!

Dr's here I come. I want to be a guinee pig again!!!!!! LOL!!!!
 
M

my65roses4me

New member
Sitting here in tears and need advice

I am happy to learn that the mutations that I have are being studied and look promising.

I guess that is my whole point about all of this is that all along the studies pertain to me and I didn't even know it. This news that I have gotten is good news and thats why I feel cheated. But at the same time I feel a little more hope for my future with all the news meds that are being studied!!!

I hope I didn't make this sound like its bad news. Its not at all. I am crying out of happiness and shock and a little hurt that I had to find out like this, I wish I knew all along!
It just makes me look at things differently now. I am 32 yrs old and have always thought of myself very informed about my disease. Which I still am but its different now. I need to keep up on the studies that are happening that I thought I couldn't be a part of. I am on the study bandwagon now!!!!!!

Dr's here I come. I want to be a guinee pig again!!!!!! LOL!!!!
 
R

Rebjane

Super Moderator
Sitting here in tears and need advice

My daughter is W1282X and delta F508. So I guess she has class 1 and class 2 mutations. PTC124 is a drug as others have stated that targets the nonsense mutations(those ending in an X) as others have previously stated. It is actually an oral drug in clinical trials. One doc once said to me "your daughters mutations are worse than having double delta F508." He was not a CF doc, though but those words stung. So much more comes into play than your specific mutations when it comes to CF as I'm sure you know, there are modifying genes, environment, compliance, economic etc. I just try to do our best with I can control and make the best life for my daughter and family as possible.
 
R

Rebjane

Super Moderator
Sitting here in tears and need advice

My daughter is W1282X and delta F508. So I guess she has class 1 and class 2 mutations. PTC124 is a drug as others have stated that targets the nonsense mutations(those ending in an X) as others have previously stated. It is actually an oral drug in clinical trials. One doc once said to me "your daughters mutations are worse than having double delta F508." He was not a CF doc, though but those words stung. So much more comes into play than your specific mutations when it comes to CF as I'm sure you know, there are modifying genes, environment, compliance, economic etc. I just try to do our best with I can control and make the best life for my daughter and family as possible.
 
R

Rebjane

Super Moderator
Sitting here in tears and need advice

My daughter is W1282X and delta F508. So I guess she has class 1 and class 2 mutations. PTC124 is a drug as others have stated that targets the nonsense mutations(those ending in an X) as others have previously stated. It is actually an oral drug in clinical trials. One doc once said to me "your daughters mutations are worse than having double delta F508." He was not a CF doc, though but those words stung. So much more comes into play than your specific mutations when it comes to CF as I'm sure you know, there are modifying genes, environment, compliance, economic etc. I just try to do our best with I can control and make the best life for my daughter and family as possible.
 
R

Rebjane

Super Moderator
Sitting here in tears and need advice

My daughter is W1282X and delta F508. So I guess she has class 1 and class 2 mutations. PTC124 is a drug as others have stated that targets the nonsense mutations(those ending in an X) as others have previously stated. It is actually an oral drug in clinical trials. One doc once said to me "your daughters mutations are worse than having double delta F508." He was not a CF doc, though but those words stung. So much more comes into play than your specific mutations when it comes to CF as I'm sure you know, there are modifying genes, environment, compliance, economic etc. I just try to do our best with I can control and make the best life for my daughter and family as possible.
 
R

Rebjane

Super Moderator
Sitting here in tears and need advice

My daughter is W1282X and delta F508. So I guess she has class 1 and class 2 mutations. PTC124 is a drug as others have stated that targets the nonsense mutations(those ending in an X) as others have previously stated. It is actually an oral drug in clinical trials. One doc once said to me "your daughters mutations are worse than having double delta F508." He was not a CF doc, though but those words stung. So much more comes into play than your specific mutations when it comes to CF as I'm sure you know, there are modifying genes, environment, compliance, economic etc. I just try to do our best with I can control and make the best life for my daughter and family as possible.
 
R

Rebjane

Super Moderator
Sitting here in tears and need advice

My daughter is W1282X and delta F508. So I guess she has class 1 and class 2 mutations. PTC124 is a drug as others have stated that targets the nonsense mutations(those ending in an X) as others have previously stated. It is actually an oral drug in clinical trials. One doc once said to me "your daughters mutations are worse than having double delta F508." He was not a CF doc, though but those words stung. So much more comes into play than your specific mutations when it comes to CF as I'm sure you know, there are modifying genes, environment, compliance, economic etc. I just try to do our best with I can control and make the best life for my daughter and family as possible.
 
You must log in or register to reply here.
Top