You are using an out of date browser. It may not display this or other websites correctly.
You should upgrade or use an alternative browser.
You should upgrade or use an alternative browser.
CF MUTATIONS
- Thread starter anonymous
- Start date
wanderlost
New member
I'm bringing this back up to the top cuz I just had an epiphany to remind me what my second mutation is - i had my typing done when pregnant with my son 7 years ago and sorta went, oh that's nice and forgot - so I am DF508 and s549n ( I think or it might be s549i) and I was trying to figure out what class the s549 fell into, but no luck. Anyone able to help me out? Maybe I am not looking in the right places....anyone have this mutation? The s549 part I mean.
<div class="FTQUOTE"><begin quote><i>Originally posted by: <b>LouLou</b></i>
amy, They haven't figured out how to detect what modifier genes a person has, have they?</end quote></div>
They're doing studies on what they think are modifier genes, but there may be some genes that aren't identified yet.
Ongoing research and no tests are out yet...
amy, They haven't figured out how to detect what modifier genes a person has, have they?</end quote></div>
They're doing studies on what they think are modifier genes, but there may be some genes that aren't identified yet.
Ongoing research and no tests are out yet...
thelizardqueen
New member
<div class="FTQUOTE"><begin quote><i>Originally posted by: <b>amy</b></i>
I have a rare on, Delta 507i that I'm curious what class it is.</end quote></div>
Do you mean Delta I507? cause that one is a class II I believe.
I have a rare on, Delta 507i that I'm curious what class it is.</end quote></div>
Do you mean Delta I507? cause that one is a class II I believe.
thelizardqueen
New member
Its in the gene thread started by Loulou...scroll down one or two threads.
<b>edited to add: its the media age thread.</b>
<b>edited to add: its the media age thread.</b>
<div class="FTQUOTE"><begin quote><i>Originally posted by: <b>thelizardqueen</b></i>
Its in the gene thread started by Loulou...scroll down one or two threads.
<b>edited to add: its the media age thread.</b></end quote></div>
I can't find that threat <img src="i/expressions/face-icon-small-sad.gif" border="0"> How do I find it?
Its in the gene thread started by Loulou...scroll down one or two threads.
<b>edited to add: its the media age thread.</b></end quote></div>
I can't find that threat <img src="i/expressions/face-icon-small-sad.gif" border="0"> How do I find it?
KristasMom
New member
Allie - My heat really goes out to you. I've been there. Time will help you heal but there IS a part of you that will always be lost. I know. I lost my 5 year old 30 years ago. I remember the love more than anything but still do cry for her in my heart and sometimes outloud. God Bless You.
Emily65Roses
New member
Since we're bumping it as a useful read, I will add this stuff. Read it at your leisure, it's a lot of scientific mumbo-jumbo... but it explains some of the science behind why stuff doesn't work.
There are several different types of mutations. I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA makes an acid called Histidine. The CGC makes an acid called Alanine. And so on.
Nonsense, as Allie said, stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.
Substitution mutations are when one letter gets changed for another. So GTACGCA could become GCACGCA, changing the GTA to GCA, which changes the amino acid from Histidine to Arginine.
Frameshift mutations are called additions or deletions. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. If you delete a letter, it might change our GTACGCA to something like GACGCA. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.
There are also splice mutations (like mine, called 1898+1G>A), and I don't know exactly how those work. I didn't learn that in my bio class. Hahaha. But I imagine it squishes two of those letters together, again changing the amino acids in the chain.
I know this is really kind of confusing, if anyone needs anything further explained or rephrased, just ask and I'll try my best.
There are several different types of mutations. I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA makes an acid called Histidine. The CGC makes an acid called Alanine. And so on.
Nonsense, as Allie said, stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.
Substitution mutations are when one letter gets changed for another. So GTACGCA could become GCACGCA, changing the GTA to GCA, which changes the amino acid from Histidine to Arginine.
Frameshift mutations are called additions or deletions. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. If you delete a letter, it might change our GTACGCA to something like GACGCA. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.
There are also splice mutations (like mine, called 1898+1G>A), and I don't know exactly how those work. I didn't learn that in my bio class. Hahaha. But I imagine it squishes two of those letters together, again changing the amino acids in the chain.
I know this is really kind of confusing, if anyone needs anything further explained or rephrased, just ask and I'll try my best.
Emily65Roses
New member
Since we're bumping it as a useful read, I will add this stuff. Read it at your leisure, it's a lot of scientific mumbo-jumbo... but it explains some of the science behind why stuff doesn't work.
There are several different types of mutations. I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA makes an acid called Histidine. The CGC makes an acid called Alanine. And so on.
Nonsense, as Allie said, stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.
Substitution mutations are when one letter gets changed for another. So GTACGCA could become GCACGCA, changing the GTA to GCA, which changes the amino acid from Histidine to Arginine.
Frameshift mutations are called additions or deletions. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. If you delete a letter, it might change our GTACGCA to something like GACGCA. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.
There are also splice mutations (like mine, called 1898+1G>A), and I don't know exactly how those work. I didn't learn that in my bio class. Hahaha. But I imagine it squishes two of those letters together, again changing the amino acids in the chain.
I know this is really kind of confusing, if anyone needs anything further explained or rephrased, just ask and I'll try my best.
There are several different types of mutations. I will use the short sequence GTACGCA as a genetic example to show all the different types. Let me first explain very simply how this stuff works. A C G T all stand for different bases. Every three are read together, to make different amino acids. For example, GTA makes an acid called Histidine. The CGC makes an acid called Alanine. And so on.
Nonsense, as Allie said, stops the chain altogether. If that GTACGC sequence was lengthened to GTACGCATCGATGCTGGTATCGATTC, a nonsense mutation would be in there somewhere and would cut the chain completely off. There are certain combinations of letters in the genetic code that stop the chain wherever it is, no matter what it's doing. That's a nonsense.
Substitution mutations are when one letter gets changed for another. So GTACGCA could become GCACGCA, changing the GTA to GCA, which changes the amino acid from Histidine to Arginine.
Frameshift mutations are called additions or deletions. One letter is added or deleted from what's supposed to be there and that changes every amino acid down the line. If you have take our example of GTACGCA and add a letter in, it would become something like CGTACGCA. That changes the acids from (GTA) Histidine and (CGC) Alanine to (CGT) Alanine and (ACG) Cysteine. If you delete a letter, it might change our GTACGCA to something like GACGCA. That changes our last two acids from (GTA) Histidine and (CGC) Alanine to (GAC) Leucine and (GCA) Arginine.
There are also splice mutations (like mine, called 1898+1G>A), and I don't know exactly how those work. I didn't learn that in my bio class. Hahaha. But I imagine it squishes two of those letters together, again changing the amino acids in the chain.
I know this is really kind of confusing, if anyone needs anything further explained or rephrased, just ask and I'll try my best.